Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05174

HP ID(1) HP05174
Gene ID(2)
Gene Symbol finder WASL(upstream, opposite)
Protein Name CDNA clone IMAGE:4453251
RefSeq
Length of RefSeq (bp) 2109
Chromosome 7q31.32
Reference DDBJ accession BC067285.1
UniGene Hs.12798

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb01H01 pKA1U5 GCCCCTTCCGGCCGAGGCGCGGACCGCGCGGAGCTAAGTGGAATCCCGGTTGGCTTGGGG
RBd52G04 pGCAP10 GGGCCGAGGCGCGGACCGCGCGGAGCTAAGTGGAATCCCGGTTGGCTTGGGGCGCAGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl