Prev. |  Human A to Z list >  A >  AFDN > 

RBd05D03 - NRCD Human cDNA Clone

Catalog Number HKR362075
Clone Name RBd05D03
Clone info. Plasmid clone of human MLLT4 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGTGGCTCGCGGCGCCCCTTCGCCGTGGCCGGGATGGAGCCTGTGACGCGCGCTGTGCTT
Sequence, submitted(3) AB621809 [link]
Note Full cds when compared using AB621809 match to NM_001291964.2 (1-7753) CDS:full/var
 
Sequence, refered NM_001291964.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) AFDN (NCBI Gene 4301)  other clone of AFDN in our bank
Synonyms AF6|MLL-AF6|MLLT4|l-afadin
Protein Name afadin, adherens junction formation factor
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR362075 RBd05D03 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd05D03 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR362075).

Sequence information

Restriction map is not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
RBd05D03a.seq   RBd05D03c.seq RBd05D03z.seq RBd05D03.pdf

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2023.06.29

NRCDhumcloneList_RB_2023May03.csv - DataSheet_NRCD_html_230606.pl