Prev. |  Human A to Z list >  R >  RNASEH1 > 

RBb30G05 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR332149
Clone Name RBb30G05
Clone info. Plasmid clone of human RNASEH1 cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) GTTGAGCGCCGGCGGCTCGCGCCCACGCTGGGCCGGGAGTCGAAATGCTTCCCGGTGCCG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_002936.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RNASEH1 (NCBI Gene 246243)  other clone of RNASEH1 in our bank
Synonyms H1RNA|PEOB2|RNH1
Protein Name ribonuclease H1
KEGG hsa:246243
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR332149 RBb30G05 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
RBb30G05a.seq   RBb30G05c.seq   RBb30G05.pdf

References and tips

Featured content

Reference


2018.10.13

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_180123.pl