RBb21C08 NRCD Human cDNA Clone

Prev. | Human A to Z list > A > ASTN2 >

RBb21C08 - NRCD Human cDNA Clone


Catalog Number	HKR328456
Clone Name	RBb21C08
Clone info.	Plasmid clone of human ASTN2 cDNA with SV40 promoter
Vector⁽¹⁾	pKA1U5
5'-terminal sequence⁽²⁾	GGTCGTGCAGCTGGCCCCAAGCGCGCGGGGCAAGGCGGCCCTGCAGGGGTGAGCTTTCCT
Sequence, submitted⁽³⁾	n.a.
Note	Valiant (Probably not NM_014010.)
Sequence, refered	NM_014010.3 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	ASTN2 (NCBI Gene 23245) other clone of ASTN2 in our bank
Synonyms	bA67K19.1
Protein Name	astrotactin 2

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR328456	RBb21C08	DNA solution

How to cite this biological resource

Materials & Methods section:

The RBb21C08 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR328456).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (by primer A)	Seq File (by primer B)	Seq File (by primer C)	Seq File (contig)	PDF File
RBb21C08a.seq		RBb21C08c.seq		RBb21C08.pdf