Prev. |  Human A to Z list >  S >  SNHG20 > 

RBb02C03 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR320851
Clone Name RBb02C03
Clone info. Plasmid clone of human C17orf86 cDNA with SV40 promoter
Vector Click for information pKA1U5
5'-terminal sequence(1) GGCAGTCCGCAGGTATGACTCAGGGCAGCCCTGACCACAGATTCCGCCGCCATCGGCCCT
Sequence, submitted(2) n.a.
 
Sequence, refered XR_041718.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) SNHG20 (NCBI Gene 654434)  other clone of SNHG20 in our bank
Synonyms C17orf86|LINC00338|NCRNA00338|SCARNA16HG
Protein Name small nucleolar RNA host gene 20
KEGG hsa:654434
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR320851 RBb02C03 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.05.24

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_180123.pl