Prev. | 

RIKEN DNA Bank Human Resource - SNHG20

Gene ID NCBI Gene 654434 |  KEGG hsa:654434
Gene Symbol SNHG20
Protein Name small nucleolar RNA host gene 20
Synonyms C17orf86|LINC00338|NCRNA00338|SCARNA16HG
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR320851 RBb02C03 pKA1U5 XR_041718.1  
GGCAGTCCGCAGGTATGACTCAGGGCAGCCCTGACCACAGATTCCGCCGCCATCGGCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl