Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11128

HP ID(1) HP11128
Gene ID(2) 51517
Gene Symbol finder NCKIPSD
Protein Name NCK interacting protein with SH3 domain
RefSeq NM_016453.2
Length of RefSeq (bp) 3023
Chromosome 3p21
Reference DDBJ accession
UniGene Hs.655006

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25H04 pKA1U5 GGTTAGAACCAGGATCCACCCCATCGCGGGAGCCGCACCCTGNTGGAGCGTTCTGGGGTC
RBdS104I11 pGCAP10 GGGGACAACCGCGGCGCGGCTCGGCGCTCCGGGCCTGGCGTTGTGGCGCCGCAGCCCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl