Prev. | 

RIKEN DNA Bank Human Resource - NCKIPSD

Gene ID NCBI Gene 51517 |  KEGG hsa:51517
Gene Symbol NCKIPSD
Protein Name NCK interacting protein with SH3 domain
Synonyms AF3P21|DIP|DIP1|ORF1|SPIN90|VIP54|WASLBP|WISH
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086191 IRAL015H23 pOTB7 BC006255 NM_184231 Partial/var
HGY093784 IRAL034H16 pOTB7 BC016052 NM_184231 Full
HGY094964 IRAL037G20 pDNR-LIB BC026280 NM_184231 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016553 W01A041G09 pENTR-TOPO IRAL034H16 BC016052 NM_184231  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050172 ARe25H04 pKA1U5 NM_016453.2  
GGTTAGAACCAGGATCCACCCCATCGCGGGAGCCGCACCCTGNTGGAGCGTTCTGGGGTC
HKR441803 RBdS104I11 pGCAP10 NM_016453.2  
GGGGACAACCGCGGCGCGGCTCGGCGCTCCGGGCCTGGCGTTGTGGCGCCGCAGCCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl