Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCKIPSD

Gene ID (NCBI) 51517
Gene Symbol NCKIPSD
Protein Name NCK interacting protein with SH3 domain
Synonyms AF3P21|DIP|DIP1|ORF1|SPIN90|VIP54|WASLBP|WISH
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086191 IRAL015H23 pOTB7 BC006255 NM_184231 Partial/var
HGY093784 IRAL034H16 pOTB7 BC016052 NM_184231 Full
HGY094964 IRAL037G20 pDNR-LIB BC026280 NM_184231 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE016553 W01A041G09 pENTR-TOPO IRAL034H16 BC016052 NM_184231  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050172 ARe25H04 pKA1U5 NM_016453.2  
GGTTAGAACCAGGATCCACCCCATCGCGGGAGCCGCACCCTGNTGGAGCGTTCTGGGGTC
HKR441803 RBdS104I11 pGCAP10 NM_016453.2  
GGGGACAACCGCGGCGCGGCTCGGCGCTCCGGGCCTGGCGTTGTGGCGCCGCAGCCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl