Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11106

HP ID(1) HP11106
Gene ID(2)
Gene Symbol finder C5orf49(exon1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 5p15.31
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS085E14 pGCAP10 AB371551 GGCCCAGTCCGCGGTCCTCACCCGCGCCGGGCGGTAGTAGTAGCTGTGCTCTTTGGGGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl