Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - ARiS085E14

Ordering information ordering information
Catalog Number HKR234110
Clone Name ARiS085E14
Vector plasmidClick for information pGCAP10
Description Plasmid clone of human C5orf49(exon1, antisense) cDNA with SV40 promoter
5'-terminal sequence(1) GGCCCAGTCCGCGGTCCTCACCCGCGCCGGGCGGTAGTAGTAGCTGTGCTCTTTGGGGTC
Sequence, submitted(2) AB371551 link 01
 
HP ID HP11106  finder other clones in this HP group.
Sequence, refered
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

Restriction map is not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_160109.pl