Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11041

HP ID(1) HP11041
Gene ID(2)
Gene Symbol finder VEZF1(exon1, antisense)
Protein Name no EST
RefSeq
Length of RefSeq (bp)
Chromosome 17q22
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd23D08 pGCAP10 AB593183 GGACAACAAAGCGGCGGCGGCGGCGGCGGCAACGGCAGCGGCGGCTCCTCAACATGGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl