Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP11022

HP ID(1) HP11022
Gene ID(2) 644128
Gene Symbol finder RPL23AP53
Protein Name ribosomal protein L23a pseudogene 53
RefSeq NR_003572.2
Length of RefSeq (bp) 5811
Chromosome 8p23.3
Reference DDBJ accession
UniGene Hs.652159

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi20F06 pGCAP10 AB371513 GGCCAGTGTCTCCGCCGGTTGAAAGCGCGTGTCTGCGTCGGGTTCTGTTGGAGTGCGTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl