Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10971

HP ID(1) HP10971
Gene ID(2) 414919
Gene Symbol finder C8orf82
Protein Name chromosome 8 open reading frame 82
RefSeq NM_001001795.1
Length of RefSeq (bp) 1979
Chromosome 8q24
Reference DDBJ accession
UniGene Hs.105685

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb40G10 pGCAP1 GGGGCCCGGCCGCCACCTGCACGGCGGGGGAGCCGCTCGCCGCGGGAGCGTCAGAGGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl