Prev. | 

RIKEN DNA Bank Human Resource - C8orf82

Gene ID NCBI Gene 414919 |  KEGG hsa:414919
Gene Symbol C8orf82
Protein Name chromosome 8 open reading frame 82
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX055745 IRAK139G01 pCMV-SPORT6 BC064373 NM_001001795
HGX056411 IRAK141A11 pCMV-SPORT6 BC064829 NM_001001795 Full/var
HGX066684 IRAK166L20 pCMV-SPORT6 BC073936 NM_001001795 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096046 M01C040B22 pDONR221 MGC09-H11 BC064829 NM_001001795  
HGE096094 M01C040D22 pDONR221 MGC09-H11 BC064829 NM_001001795  
HGE096142 M01C040F22 pDONR221 MGC09-H11 BC064829 NM_001001795  
HGE096190 M01C040H22 pDONR221 MGC09-H11 BC064829 NM_001001795  
HGE096238 M01C040J22 pDONR221 MGC09-H11 BC064829 NM_001001795  
HGE096286 M01C040L22 pDONR221 MGC09-H11 BC064829 NM_001001795  
HGE096334 M01C040N22 pDONR221 MGC09-H11 BC064829 NM_001001795  
HGE096382 M01C040P22 pDONR221 MGC09-H11 BC064829 NM_001001795  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336154 RBb40G10 pGCAP1 NM_001001795.1  
GGGGCCCGGCCGCCACCTGCACGGCGGGGGAGCCGCTCGCCGCGGGAGCGTCAGAGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl