Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10903

HP ID(1) HP10903
Gene ID(2)
Gene Symbol finder B4GALT1 (exon 1, antisense)
Protein Name Transcribed locus
RefSeq
Length of RefSeq (bp)
Chromosome 9p21.1
Reference DDBJ accession
UniGene Hs.545818

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe55A06 pKA1U5 AB371488 GGGAGGACTGCCCGATGGCGGCGGCACTGTTCGAGCCGCCCTGCAGCGGTGTGGAGACTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl