Prev. |  Human A to Z list >   >   > 

ARe55A06 - NRCD Human cDNA Clone

Catalog Number HKR062006
Clone Name ARe55A06
Clone info. Plasmid clone of human B4GALT1 (exon 1, antisense) cDNA with SV40 promoter
Vector(1) pKA1U5
5'-terminal sequence(2) GGGAGGACTGCCCGATGGCGGCGGCACTGTTCGAGCCGCCCTGCAGCGGTGTGGAGACTC
Sequence, submitted(3) AB371488 [link]
 
Sequence, refered
HP ID HP10903   other clones in this HP group.
Protein Name
Links

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR062006 ARe55A06 DNA solution

How to cite this biological resource

Materials & Methods section:

The ARe55A06 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR062006).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2023.05.02

NRCDhumcloneList_AR_2023Apr25.csv - GNP_filter3_NRCD_html_230424.pl