Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10886

HP ID(1) HP10886
Gene ID(2) 6092
Gene Symbol finder ROBO2
Protein Name roundabout, axon guidance receptor, homolog 2 (Drosophila)
RefSeq NM_002942.3
Length of RefSeq (bp) 6254
Chromosome 3p12.3
Reference DDBJ accession
UniGene Hs.13305

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb07D10 pKA1U5 GACCCGCGGCAGCTGCCGGAGGAAGCGGACGCTCTGCTGCGAGGCTGCGGGGGCTGGACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl