Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10864

HP ID(1) HP10864
Gene ID(2) 494514
Gene Symbol finder C18orf56
Protein Name chromosome 18 open reading frame 56
RefSeq NM_001012716.1
Length of RefSeq (bp) 860
Chromosome 18p11.32
Reference DDBJ accession
UniGene Hs.274959

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe23B09 pKA1U5 GAGGACTAAACGGGGTTCCGCAGCGCCCGGCAGCTCCCGAGCGCTCTCCCCAGCCGCGCC
RBd22F05 pGCAP10 GACAGGGGAAACGGAGGAGGGGCCAAAGCCAGGACTTTGAGACCGGCGCGCGGTCAGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl