Prev. | 

RIKEN DNA Bank Human Resource - TYMSOS

Gene ID NCBI Gene 494514 |  KEGG hsa:494514
Gene Symbol TYMSOS
Protein Name TYMS opposite strand
Synonyms C18orf56
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020974 IRAK052H06 pCMV-SPORT6 BC028301 NM_001012716

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE093238 M01C033B14 pDONR221 MGC06-D07 BC028301 ENST00000323813  
HGE093286 M01C033D14 pDONR221 MGC06-D07 BC028301 ENST00000323813  
HGE093334 M01C033F14 pDONR221 MGC06-D07 BC028301 ENST00000323813  
HGE093382 M01C033H14 pDONR221 MGC06-D07 BC028301 ENST00000323813  
HGE093430 M01C033J14 pDONR221 MGC06-D07 BC028301 ENST00000323813  
HGE093478 M01C033L14 pDONR221 MGC06-D07 BC028301 ENST00000323813  
HGE093526 M01C033N14 pDONR221 MGC06-D07 BC028301 ENST00000323813  
HGE093574 M01C033P14 pDONR221 MGC06-D07 BC028301 ENST00000323813  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049233 ARe23B09 pKA1U5 NM_001012716.1  
GAGGACTAAACGGGGTTCCGCAGCGCCCGGCAGCTCCCGAGCGCTCTCCCCAGCCGCGCC
HKR368925 RBd22F05 pGCAP10 NM_001012716.1  
GACAGGGGAAACGGAGGAGGGGCCAAAGCCAGGACTTTGAGACCGGCGCGCGGTCAGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl