Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10859

HP ID(1) HP10859
Gene ID(2) 55000
Gene Symbol finder TUG1
Protein Name taurine upregulated 1 (non-protein coding)
RefSeq NR_002323.1
Length of RefSeq (bp) 7115
Chromosome 22q12.2
Reference DDBJ accession
UniGene Hs.554829

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe18C09 pKA1U5 GGCCATTTAAAGAAACAGTACCGGGGGCGGGCCGAGCGACGCAGCCGGGACGGTAGCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl