Prev. | 

RIKEN DNA Bank Human Resource - TUG1

Gene ID NCBI Gene 55000 |  KEGG hsa:55000
Gene Symbol TUG1
Protein Name taurine up-regulated 1
Synonyms LINC00080|NCRNA00080|TI-227H
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15794 pTnT-TUG1 exon1 Expression vector of long non-coding RNA, human TUG1 exon1 for in vitro transcription.
RDB15795 pTnT-TUG1 exon2 Expression vector of long non-coding RNA, human TUG1 exon2 for in vitro transcription.
RDB15796 pTnT-TUG1 exon3 Expression vector of long non-coding RNA, human TUG1 exon3 for in vitro transcription.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031543 IRAK078O07 pCMV-SPORT6 BC037986 NR_002323

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047257 ARe18C09 pKA1U5 NR_002323.1  
GGCCATTTAAAGAAACAGTACCGGGGGCGGGCCGAGCGACGCAGCCGGGACGGTAGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.22

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl