Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10818

HP ID(1) HP10818
Gene ID(2) 57050
Gene Symbol finder UTP3
Protein Name UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)
RefSeq NM_020368.2
Length of RefSeq (bp) 2088
Chromosome 4q13.3
Reference DDBJ accession
UniGene Hs.322901

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe44F01 pKA1U5 GAGTAGCCGATCAGGAGTCTGCAAACTCCGGTGGTATGGGAGCGCGCTGCTGTTTAGAGC
RBb16H02 pKA1U5 GGCGCTGCTGTTTAGAGCCACGAGTTACCGGAGCGCCTGATTCCTGCGCCGAAGTCAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl