Prev. |  KEGG KO K14767 > 

RIKEN DNA Bank Human Resource - UTP3

Gene ID NCBI Gene 57050 |  KEGG hsa:57050
Gene Symbol UTP3
Protein Name UTP3 small subunit processome component
Synonyms CRL1|CRLZ1|SAS10
Ortholog resource in our bank

  UTP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086319 IRAL015N07 pOTB7 BC004546 NM_020368 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057721 ARe44F01 pKA1U5 NM_020368.2  
GAGTAGCCGATCAGGAGTCTGCAAACTCCGGTGGTATGGGAGCGCGCTGCTGTTTAGAGC
HKR326570 RBb16H02 pKA1U5 NM_020368.2  
GGCGCTGCTGTTTAGAGCCACGAGTTACCGGAGCGCCTGATTCCTGCGCCGAAGTCAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl