Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10803

HP ID(1) HP10803
Gene ID(2) 29965
Gene Symbol finder C16orf5
Protein Name chromosome 16 open reading frame 5
RefSeq NM_013399.2
Length of RefSeq (bp) 2742
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.654653

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi54C11 pGCAP10 TGAGCTGCCGAGGCGTTCGGTCCTGCTGTTGCGGCCGCTGCCCCAGGGCTGCGGGGACGC
RBb12A06 pKA1U5 ATCCTGGGTGCGACTGCCAGCTGCCGAGGCGTTCGGTCCTGCTGTTGCGGCCGCTGCCCC
RBd97A05 pGCAP10 GCTAGTCTACCCGCCTCCTTGTGACAGAAGTGCGACTGCCAGCTGCCGAGGCGTTCGGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl