Prev. | 

RIKEN DNA Bank Human Resource - CDIP1

Gene ID NCBI Gene 29965 |  KEGG hsa:29965
Gene Symbol CDIP1
Protein Name cell death inducing p53 target 1
Synonyms C16orf5|CDIP|I1|LITAFL
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086153 IRAL015G09 pOTB7 BC002882 NM_013399 Full/var
HGY089130 IRAL022N18 pOTB7 BC007604 NM_013399 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040455 W01A101C07 pENTR-TOPO IRAL015G09 BC002882 NM_013399  
HGE040465 W01A101C17 pENTR-TOPO IRAL015G09 BC002882 NM_013399  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR181659 ARi54C11 pGCAP10 NM_013399.2  
TGAGCTGCCGAGGCGTTCGGTCCTGCTGTTGCGGCCGCTGCCCCAGGGCTGCGGGGACGC
HKR324806 RBb12A06 pKA1U5 NM_013399.2  
ATCCTGGGTGCGACTGCCAGCTGCCGAGGCGTTCGGTCCTGCTGTTGCGGCCGCTGCCCC
HKR398805 RBd97A05 pGCAP10 NM_013399.2  
GCTAGTCTACCCGCCTCCTTGTGACAGAAGTGCGACTGCCAGCTGCCGAGGCGTTCGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl