Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10776

HP ID(1) HP10776
Gene ID(2) 80762
Gene Symbol finder NDFIP1
Protein Name Nedd4 family interacting protein 1
RefSeq NM_030571.2
Length of RefSeq (bp) 2533
Chromosome 5q31.3
Reference DDBJ accession
UniGene Hs.9788

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe13A10 pKA1U5 GGAGAAGAGCGTCTCGCCCGGGAGCGGCGGCGGCCATCGAGACCCACCCAAGGCGCGTCC
ARe24B03 pKA1U5 GGGGCCGCGTCGGAGCCTCCGCGGCGGCGGCGGTGCTTACAGCCTGAGAAGAGCGTCTCG
RBd03H05 pGCAP10 GGCCTCGGCGGCGGCGGCGGTGCTTACAGCCTGAGAAGAGCGTCTCGCCCGGGAGCGGCG
RBdS105K17 pGCAP10 GGAGAAGAGCGTCTCGCCCGGGAGCGGCGGCGGCCATCGAGACCCACCCAAGGCGCGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl