Prev. | 

RIKEN DNA Bank Human Resource - NDFIP1

Gene ID NCBI Gene 80762 |  KEGG hsa:80762
Gene Symbol NDFIP1
Protein Name Nedd4 family interacting protein 1
Synonyms N4WBP5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085546 IRAL013O10 pOTB7 BC004317 NM_030571 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024493 W01A061D21 pENTR-TOPO IRAL013O10 BC004317 NM_030571  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045210 ARe13A10 pKA1U5 NM_030571.2  
GGAGAAGAGCGTCTCGCCCGGGAGCGGCGGCGGCCATCGAGACCCACCCAAGGCGCGTCC
HKR049627 ARe24B03 pKA1U5 NM_030571.2  
GGGGCCGCGTCGGAGCCTCCGCGGCGGCGGCGGTGCTTACAGCCTGAGAAGAGCGTCTCG
HKR361373 RBd03H05 pGCAP10 NM_030571.2  
GGCCTCGGCGGCGGCGGCGGTGCTTACAGCCTGAGAAGAGCGTCTCGCCCGGGAGCGGCG
HKR442257 RBdS105K17 pGCAP10 NM_030571.2  
GGAGAAGAGCGTCTCGCCCGGGAGCGGCGGCGGCCATCGAGACCCACCCAAGGCGCGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl