Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10753

HP ID(1) HP10753
Gene ID(2) 114908
Gene Symbol finder TMEM123
Protein Name transmembrane protein 123
RefSeq NM_052932.2
Length of RefSeq (bp) 3605
Chromosome 11q22.1
Reference DDBJ accession
UniGene Hs.503709

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe50H06 pKA1U5 GCCCCCGCGCCACCCAGCCCGGCCCCGCCGCCCCGGCTTGCGCACGCGACGCCCCCTCCA
ARe78G03 pKA1U5 GATTCGGGGGGCAAGCGGCGGGAGGGGAAACGTGCGCGGCCGAAGGGGAAGCGGAGCCGG
RBb29B04 pGCAP1 GGCCCGCAAAACTACTCTTCAAAGGCTTCCTTCCGGGCACCGCTAAGCCAGCGTGCTCAG
RBdS075K14 pGCAP10 GGAAGGAGAANNGGANCCGGNNCCGGGTGCNTNNAGGAGCCNNTCNNNNCTCCTCCNCCT
RBdS081M08 pGCAP10 GGACGCCCCCTCCAGGCCCCGCTCCTGCGCCCTATTTGGTCATTCGGGGGGCAAGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl