Prev. | 

RIKEN DNA Bank Human Resource - TMEM123

Gene ID NCBI Gene 114908 |  KEGG hsa:114908
Gene Symbol TMEM123
Protein Name transmembrane protein 123
Synonyms KCT3|PORIMIN|PORMIN
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025613 IRAK064A13 pCMV-SPORT6 BC032296 NM_052932 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024738 W01A061O02 pENTR-TOPO flj0027m14 AK075420 NM_052932  
HGE024742 W01A061O06 pENTR-TOPO flj0027m14 AK075420 NM_052932  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060174 ARe50H06 pKA1U5 NM_052932.2  
GCCCCCGCGCCACCCAGCCCGGCCCCGCCGCCCCGGCTTGCGCACGCGACGCCCCCTCCA
HKR071347 ARe78G03 pKA1U5 NM_052932.2  
GATTCGGGGGGCAAGCGGCGGGAGGGGAAACGTGCGCGGCCGAAGGGGAAGCGGAGCCGG
HKR331628 RBb29B04 pGCAP1 NM_052932.2  
GGCCCGCAAAACTACTCTTCAAAGGCTTCCTTCCGGGCACCGCTAAGCCAGCGTGCTCAG
HKR430254 RBdS075K14 pGCAP10 NM_052932.2  
GGAAGGAGAANNGGANCCGGNNCCGGGTGCNTNNAGGAGCCNNTCNNNNCTCCTCCNCCT
HKR432696 RBdS081M08 pGCAP10 NM_052932.2  
GGACGCCCCCTCCAGGCCCCGCTCCTGCGCCCTATTTGGTCATTCGGGGGGCAAGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl