Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10743

HP ID(1) HP10743
Gene ID(2) 92610
Gene Symbol finder TIFA
Protein Name TRAF-interacting protein with a forkhead-associated domain
RefSeq NM_052864.2
Length of RefSeq (bp) 3090
Chromosome 4q25
Reference DDBJ accession
UniGene Hs.310640

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi80H06 pGCAP10 GACTTACCCGCGCGGAGGAGCAGCGGCCGGGTGTCCACCCCCATCCTGCGCCCAGTCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl