Prev. | 

RIKEN DNA Bank Human Resource - TIFA

Gene ID NCBI Gene 92610 |  KEGG hsa:92610
Gene Symbol TIFA
Protein Name TRAF interacting protein with forkhead associated domain
Synonyms T2BP|T6BP|TIFAA
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087432 IRAL018J16 pOTB7 BC008294 NM_052864 Full/var
HGY092376 IRAL030P16 pOTB7 BC014259 NM_052864 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100441 M01C051B17 pDONR221 MGC15-C09 BC014259 NM_052864  
HGE100489 M01C051D17 pDONR221 MGC15-C09 BC014259 NM_052864  
HGE100537 M01C051F17 pDONR221 MGC15-C09 BC014259 NM_052864  
HGE100585 M01C051H17 pDONR221 MGC15-C09 BC014259 NM_052864  
HGE100633 M01C051J17 pDONR221 MGC15-C09 BC014259 NM_052864  
HGE100681 M01C051L17 pDONR221 MGC15-C09 BC014259 NM_052864  
HGE100729 M01C051N17 pDONR221 MGC15-C09 BC014259 NM_052864  
HGE100777 M01C051P17 pDONR221 MGC15-C09 BC014259 NM_052864  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR192174 ARi80H06 pGCAP10 NM_052864.2  
GACTTACCCGCGCGGAGGAGCAGCGGCCGGGTGTCCACCCCCATCCTGCGCCCAGTCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl