Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10742

HP ID(1) HP10742
Gene ID(2) 340061
Gene Symbol finder TMEM173
Protein Name transmembrane protein 173
RefSeq NM_198282.1
Length of RefSeq (bp) 1714
Chromosome 5q31.2
Reference DDBJ accession
UniGene Hs.379754

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi23H06 pGCAP10 GAGAAGAAAAATATGAGACGGGGAATCATCGTGTGATGTGTGTGCTGCCTTTGGCTGAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl