Prev. |  KEGG KO K12654 > 

RIKEN DNA Bank Human Resource - STING1

Gene ID NCBI Gene 340061 |  KEGG hsa:340061
Gene Symbol STING1
Protein Name stimulator of interferon response cGAMP interactor 1
Synonyms ERIS|MITA|MPYS|NET23|SAVI|STING|STING-beta|TMEM173|hMITA|hSTING
Featured content SARS-CoV-2 relevant human genes
Ortholog resource in our bank

  STING1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14351 pBabe-hSTING(WT) Retroviral expression vector of human STING.
RDB14352 pBabe-hSTING(C88/91S) Retroviral expression vector of human STING, C88/91S mutant.
RDB14353 pBabe-hSTING(V147L) Retroviral expression vector of human STING, V147L mutant.
RDB14354 pBabe-hSTING(N154S) Retroviral expression vector of human STING, N154S mutant.
RDB14355 pBabe-hSTING(V155M) Retroviral expression vector of human STING, V155M mutant.
RDB14356 pBabe-hSTING(V147L_C88S_C91S) Retroviral expression vector of human STING, V147L_C88S_C91S mutant.
RDB14357 pBabe-hSTING(N154S_C88S_C91S) Retroviral expression vector of human STING, N154S_C88S_C91S mutant.
RDB14358 pBabe-hSTING(V155M_C88S_C91S) Retroviral expression vector of human STING, V155M_C88S_C91S mutant.

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169374 ARi23H06 pGCAP10 NM_198282.1  
GAGAAGAAAAATATGAGACGGGGAATCATCGTGTGATGTGTGTGCTGCCTTTGGCTGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl