DNA Bank Top |  KEGG KO K12654 > 

RIKEN DNA Bank Human Resource - STING1

Gene ID NCBI Gene 340061 |  KEGG hsa:340061
Gene Symbol STING1
Protein Name stimulator of interferon response cGAMP interactor 1
Synonyms ERIS|MITA|MPYS|NET23|SAVI|STING|STING-beta|TMEM173|hMITA|hSTING
Featured content SARS-CoV-2 relevant human genes

Link

Ortholog resource in our bank

  STING1

External database

human STING1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB14358 pBabe-hSTING(V155M_C88S_C91S) Retroviral expression vector of human STING, V155M_C88S_C91S mutant.    
RDB14357 pBabe-hSTING(N154S_C88S_C91S) Retroviral expression vector of human STING, N154S_C88S_C91S mutant.    
RDB14356 pBabe-hSTING(V147L_C88S_C91S) Retroviral expression vector of human STING, V147L_C88S_C91S mutant.    
RDB14355 pBabe-hSTING(V155M) Retroviral expression vector of human STING, V155M mutant.    
RDB14354 pBabe-hSTING(N154S) Retroviral expression vector of human STING, N154S mutant.    
RDB14353 pBabe-hSTING(V147L) Retroviral expression vector of human STING, V147L mutant.    
RDB14352 pBabe-hSTING(C88/91S) Retroviral expression vector of human STING, C88/91S mutant.    
RDB14351 pBabe-hSTING(WT) Retroviral expression vector of human STING.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169374 ARi23H06 pGCAP10 NM_198282.1  
GAGAAGAAAAATATGAGACGGGGAATCATCGTGTGATGTGTGTGCTGCCTTTGGCTGAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.24

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl