Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10726

HP ID(1) HP10726
Gene ID(2) 57414
Gene Symbol finder RHBDD2
Protein Name rhomboid domain containing 2
RefSeq NM_001040456.1
Length of RefSeq (bp) 1756
Chromosome 7q11.23
Reference DDBJ accession
UniGene Hs.488827

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe50D04 pKA1U5 TGAGAGGACCGGCAGCCGGCGTCGAGGCGGGGCGCGGGAACGACGGCGGCCATGGCGGCC
ARiS118O22 pGCAP10 GCCTCCTCTGCTGTTGCCAAGGGAAACTGCCGCGAGGAGGCGGAAGGAGCAGAGGACCGG
RBb10F01 pKA1U5 AAGGAGCAGAGGACCGGCAGCCGGCGTCGAGGCGGGGCGCGGGAACGACGGCGGCCATGG
RBb58H12 pGCAP1 GGGCGTCGAGGCGGGGCGCGGGAACGACGGCGGCCATGGCGGCCTCGGGGCCCGGGTGTC
RBd75A04 pGCAP10 GGGGGCGCGGGAACGACGGCGGCCATGGCGGCCTCGGGGCCCGGGTGTCGCAGCTGGTGC
RBdS015N13 pGCAP10 GGAGGAGGCGGAAGGAGCAGAGGACCGGCAGCCGGCGTCGAGGCGGGGCGCGGGAACGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl