Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10693

HP ID(1) HP10693
Gene ID(2) 54968
Gene Symbol finder TMEM70
Protein Name transmembrane protein 70
RefSeq NM_017866.4
Length of RefSeq (bp) 2030
Chromosome 8q21.11
Reference DDBJ accession
UniGene Hs.106650

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe62G11 pKA1U5 GATGCGCCACTTGTGCGGCAGTCGGGTGGGAAGCCGTGTCTCGCAGTCGTGGACTCGTGC
ARe65D07 pKA1U5 GACTTGTGCGGCAGTCGGGTGGGAAGCCGTGTCTCGCAGTCGTGGACTCGTGCAGCTGGG
RBdS154C13 pGCAP10 GACTTGTGCGGCAGTCGGGTGGGAAGCCGTGTCTCGCAGTCGTGGACTCGTGCAGCTGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl