Prev. |  KEGG KO K17966 > 

RIKEN DNA Bank Human Resource - TMEM70

Gene ID NCBI Gene 54968 |  KEGG hsa:54968
Gene Symbol TMEM70
Protein Name transmembrane protein 70
Synonyms MC5DN2
Ortholog resource in our bank

  TMEM70

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085058 IRAL012K18 pOTB7 BC002748 NM_017866 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064955 ARe62G11 pKA1U5 NM_017866.4  
GATGCGCCACTTGTGCGGCAGTCGGGTGGGAAGCCGTGTCTCGCAGTCGTGGACTCGTGC
HKR066079 ARe65D07 pKA1U5 NM_017866.4  
GACTTGTGCGGCAGTCGGGTGGGAAGCCGTGTCTCGCAGTCGTGGACTCGTGCAGCTGGG
HKR461661 RBdS154C13 pGCAP10 NM_017866.4  
GACTTGTGCGGCAGTCGGGTGGGAAGCCGTGTCTCGCAGTCGTGGACTCGTGCAGCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl