Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10689

HP ID(1) HP10689
Gene ID(2) 57136
Gene Symbol finder C20orf3
Protein Name chromosome 20 open reading frame 3
RefSeq NM_020531.2
Length of RefSeq (bp) 2251
Chromosome 20p11.22-p11.21
Reference DDBJ accession
UniGene Hs.472330

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe93D02 pKA1U5 GGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGATACCATGAGCGAGGCGGACGGG
ARi64H05 pGCAP10 GGGAGTCTGAGCCGGCGCCGCTCAGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCG
RBd58A12 pGCAP10 GGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGTACCATGAGCGAGGCGGACGGGCTG
RBd63H06 pGCAP10 GAGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGTACCATGAGCGAGGCGGACGGG
RBd71D11 pGCAP10 GAGAGTCCAGGTCTAAGCTCTTTTGCCTCCGTCCCTGTAGGCGTCCCTCAGGATCTGCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl