Prev. |  KEGG KO K21407 > 

RIKEN DNA Bank Human Resource - APMAP

Gene ID NCBI Gene 57136 |  KEGG hsa:57136
Gene Symbol APMAP
Protein Name adipocyte plasma membrane associated protein
Synonyms BSCv|C20orf3
Ortholog resources KEGG ortholog (KEGG orthology K21407) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085349 IRAL013G05 pOTB7 BC003501 NM_020531 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR077274 ARe93D02 pKA1U5 NM_020531.2  
GGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGATACCATGAGCGAGGCGGACGGG
HKR185773 ARi64H05 pGCAP10 NM_020531.2  
GGGAGTCTGAGCCGGCGCCGCTCAGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCG
HKR383212 RBd58A12 pGCAP10 NM_020531.2  
GGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGTACCATGAGCGAGGCGGACGGGCTG
HKR385374 RBd63H06 pGCAP10 NM_020531.2  
GAGTGTGAGGTGGTTTCTGCGGGTGAGGCTGGCGCCCGTACCATGAGCGAGGCGGACGGG
HKR388483 RBd71D11 pGCAP10 NM_020531.2  
GAGAGTCCAGGTCTAAGCTCTTTTGCCTCCGTCCCTGTAGGCGTCCCTCAGGATCTGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl