Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10685

HP ID(1) HP10685
Gene ID(2) 284361
Gene Symbol finder C19orf63
Protein Name chromosome 19 open reading frame 63
RefSeq NM_175063.4
Length of RefSeq (bp) 2048
Chromosome 19q13.33
Reference DDBJ accession
UniGene Hs.515550

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe95A08 pKA1U5 GGGTGGGAAGAAGCCGAGATGGCGGCAGCCAGCGCTGGGGCAACCCGGCTGCTCCTGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl