Prev. | 

RIKEN DNA Bank Human Resource - EMC10

Gene ID NCBI Gene 284361 |  KEGG hsa:284361
Gene Symbol EMC10
Protein Name ER membrane protein complex subunit 10
Synonyms C19orf63|HSM1|HSS1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018414 IRAK046A14 pBluescriptR BC032948 NM_206538 Full/var
HGY018418 IRAK046A18 pBluescriptR BC035001 NM_206538 Full/var
HGX054014 IRAK135A14 pCMV-SPORT6 BC062607 NM_206538 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE111217 M01C078A17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE111265 M01C078C17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE111313 M01C078E17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE111361 M01C078G17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE111409 M01C078I17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE111457 M01C078K17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE111505 M01C078M17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE111553 M01C078O17 pDONR221 06-2_02-E09 BC032948 NM_206538  
HGE089647 M01C024B23 pDONR221 MGC01-G12 BC032948 NM_206538  
HGE089695 M01C024D23 pDONR221 MGC01-G12 BC032948 NM_206538  
HGE089743 M01C024F23 pDONR221 MGC01-G12 BC032948 NM_206538  
HGE089791 M01C024H23 pDONR221 MGC01-G12 BC032948 NM_206538  
HGE089839 M01C024J23 pDONR221 MGC01-G12 BC032948 NM_206538  
HGE089887 M01C024L23 pDONR221 MGC01-G12 BC032948 NM_206538  
HGE089935 M01C024N23 pDONR221 MGC01-G12 BC032948 NM_206538  
HGE089983 M01C024P23 pDONR221 MGC01-G12 BC032948 NM_206538  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078008 ARe95A08 pKA1U5 NM_175063.4  
GGGTGGGAAGAAGCCGAGATGGCGGCAGCCAGCGCTGGGGCAACCCGGCTGCTCCTGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl