Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10668

HP ID(1) HP10668
Gene ID(2) 54976
Gene Symbol finder C20orf27
Protein Name chromosome 20 open reading frame 27
RefSeq NM_001039140.1
Length of RefSeq (bp) 1376
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.274422

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb17H06 pKA1U5 GGTGCTCGGCGTTGAGCTCCTGCAGCCGCCGCCGCTGCAGTGGTCGTCCCTGCCCTCCCC
RBb24F07 pGCAP1 GGTGCTCGGCGTTGAGCTCCTGCAGCCGCCGCCGCTGCAGTGGTCGTCCCTGCCCTCCCC
RBdS013C23 pGCAP10 GGGGAGGGCGGCCGCGGCGCGGGGCTCCCTTCCTCGTGCTCGGCGTTGAGCTCCTGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl