Prev. | 

RIKEN DNA Bank Human Resource - C20orf27

Gene ID NCBI Gene 54976 |  KEGG hsa:54976
Gene Symbol C20orf27
Protein Name chromosome 20 open reading frame 27
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005668 IRAK014C20 pCMV-SPORT6 BC010873 NM_001039140
HGY083489 IRAL008M01 pOTB7 BC024036 NM_001039140 Partial/var
HGY083779 IRAL009H11 pOTB7 BC012196 NM_001039140 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326974 RBb17H06 pKA1U5 NM_001039140.1  
GGTGCTCGGCGTTGAGCTCCTGCAGCCGCCGCCGCTGCAGTGGTCGTCCCTGCCCTCCCC
HKR329727 RBb24F07 pGCAP1 NM_001039140.1  
GGTGCTCGGCGTTGAGCTCCTGCAGCCGCCGCCGCTGCAGTGGTCGTCCCTGCCCTCCCC
HKR405271 RBdS013C23 pGCAP10 NM_001039140.1  
GGGGAGGGCGGCCGCGGCGCGGGGCTCCCTTCCTCGTGCTCGGCGTTGAGCTCCTGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl