Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10658

HP ID(1) HP10658
Gene ID(2) 79086
Gene Symbol finder C19orf42
Protein Name chromosome 19 open reading frame 42
RefSeq NM_024104.3
Length of RefSeq (bp) 1390
Chromosome 19p13.11
Reference DDBJ accession
UniGene Hs.356467

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb32F02 pGCAP1 GGGGCTTCCGCTTCCGGTTCTGACGGACGCTTCGGCCGTAACGATGATCGGAGACATCCT
RBb34F02 pGCAP1
RBd84B01 pGCAP10 GGGTTCTGACGGACGCTTCGGCCGTAACGATGATCGGAGACATCCTGCTGTTCGGGACGT
RBd98A08 pGCAP10 GGGCCGTAACGATGATCGGAGACATCCTGCTGTTCGGGACGTTGCTGATGAATGCCGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl