Prev. | 

RIKEN DNA Bank Human Resource - SMIM7

Gene ID NCBI Gene 79086 |  KEGG hsa:79086
Gene Symbol SMIM7
Protein Name small integral membrane protein 7
Synonyms C19orf42
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001909 IRAK004M21 pCMV-SPORT6 BC000817 NM_001300925.2
HGY080981 IRAL002H13 pOTB7 BC001680 NM_024104 Full
HGY083798 IRAL009I06 pOTB7 BC001948 NM_024104 Full
HGY101872 IRAL054L08 pOTB7 BC069279 NM_024104 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR332922 RBb32F02 pGCAP1 NM_024104.3  
GGGGCTTCCGCTTCCGGTTCTGACGGACGCTTCGGCCGTAACGATGATCGGAGACATCCT
HKR333722 RBb34F02 pGCAP1 NM_024104.3  
HKR393625 RBd84B01 pGCAP10 NM_024104.3  
GGGTTCTGACGGACGCTTCGGCCGTAACGATGATCGGAGACATCCTGCTGTTCGGGACGT
HKR399208 RBd98A08 pGCAP10 NM_024104.3  
GGGCCGTAACGATGATCGGAGACATCCTGCTGTTCGGGACGTTGCTGATGAATGCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl