Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10641

HP ID(1) HP10641
Gene ID(2) 29086
Gene Symbol finder C19orf62
Protein Name chromosome 19 open reading frame 62
RefSeq NM_014173.2
Length of RefSeq (bp) 1413
Chromosome 19p13.11
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe39D08 pKA1U5 GTGTAAAGATGGCGGCTTCCTAGTGAGTCGGCGGCTGATTTAGAAGGAGGTTCAGGCTAC
ARiS023P16 pGCAP10 GAAAGATGGCGGCTTCCTAGTGAGTCGGCGGCTGATTTAGAAGGAGGTTCAGGCTACGGG
RBb42C10 pGCAP1 GGTACAACTTCCGGCTGTAAAGATGGCGGCTTCCTAGTGAGTCGGCGGCTGATTTAGAAG
RBb50C07 pGCAP1 TGTGGTACAACTTCCGGCTGTAAAGATGGCGGCTTCCTAGNTGAGTCGGCGGCTGATTTA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl