Prev. |  KEGG KO K20776 > 

RIKEN DNA Bank Human Resource - BABAM1

Gene ID NCBI Gene 29086 |  KEGG hsa:29086
Gene Symbol BABAM1
Protein Name BRISC and BRCA1 A complex member 1
Synonyms C19orf62|HSPC142|MERIT40|NBA1
Ortholog resource in our bank

  BABAM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082905 IRAL007E09 pOTB7 BC000788 NM_014173 Full
HGY086129 IRAL015F09 pOTB7 BC006244 NM_014173 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055680 ARe39D08 pKA1U5 NM_014173.2  
GTGTAAAGATGGCGGCTTCCTAGTGAGTCGGCGGCTGATTTAGAAGGAGGTTCAGGCTAC
HKR209576 ARiS023P16 pGCAP10 NM_014173.2  
GAAAGATGGCGGCTTCCTAGTGAGTCGGCGGCTGATTTAGAAGGAGGTTCAGGCTACGGG
HKR336858 RBb42C10 pGCAP1 NM_014173.2  
GGTACAACTTCCGGCTGTAAAGATGGCGGCTTCCTAGTGAGTCGGCGGCTGATTTAGAAG
HKR340055 RBb50C07 pGCAP1 NM_014173.2  
TGTGGTACAACTTCCGGCTGTAAAGATGGCGGCTTCCTAGNTGAGTCGGCGGCTGATTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl