Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10638

HP ID(1) HP10638
Gene ID(2) 55863
Gene Symbol finder TMEM126B
Protein Name transmembrane protein 126B
RefSeq NM_018480.2
Length of RefSeq (bp) 1166
Chromosome 11q14.1
Reference DDBJ accession
UniGene Hs.525063

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe33H05 pKA1U5 GAGCCACCAAAATGGTGGTGTTCGGGTATGAGGCTGGGACTAAGCCAAGGGATTCAGGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl