Prev. |  KEGG KO K18165 > 

RIKEN DNA Bank Human Resource - TMEM126B

Gene ID NCBI Gene 55863 |  KEGG hsa:55863
Gene Symbol TMEM126B
Protein Name transmembrane protein 126B
Synonyms HT007|MC1DN29
Ortholog resource in our bank

  TMEM126B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027464 IRAK068K24 pCMV-SPORT6 BC038933 NM_018480
HGY091777 IRAL029H09 pOTB7 BC012065 NM_018480 Full/var
HGY093026 IRAL032J10 pDNR-LIB BC017574 NM_018480

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100421 M01C051A21 pDONR221 MGC15-A11 BC012065 NM_018480  
HGE100469 M01C051C21 pDONR221 MGC15-A11 BC012065 NM_018480  
HGE100517 M01C051E21 pDONR221 MGC15-A11 BC012065 NM_018480  
HGE100565 M01C051G21 pDONR221 MGC15-A11 BC012065 NM_018480  
HGE100613 M01C051I21 pDONR221 MGC15-A11 BC012065 NM_018480  
HGE100661 M01C051K21 pDONR221 MGC15-A11 BC012065 NM_018480  
HGE100709 M01C051M21 pDONR221 MGC15-A11 BC012065 NM_018480  
HGE100757 M01C051O21 pDONR221 MGC15-A11 BC012065 NM_018480  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053373 ARe33H05 pKA1U5 NM_018480.2  
GAGCCACCAAAATGGTGGTGTTCGGGTATGAGGCTGGGACTAAGCCAAGGGATTCAGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl