Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10618

HP ID(1) HP10618
Gene ID(2) 79089
Gene Symbol finder TMUB2
Protein Name transmembrane and ubiquitin-like domain containing 2
RefSeq NM_024107.2
Length of RefSeq (bp) 1942
Chromosome 17q21.31
Reference DDBJ accession
UniGene Hs.181391

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe27H04 pKA1U5 GGGAGGCTGGGGCCAGGCAGCCCTTCGGTTCGGGTGGGCCCATGGACCCCAGTCCAACGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl