Prev. | 

RIKEN DNA Bank Human Resource - TMUB2

Gene ID NCBI Gene 79089 |  KEGG hsa:79089
Gene Symbol TMUB2
Protein Name transmembrane and ubiquitin like domain containing 2
Synonyms FP2653
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE112420 M01C081A20 pDONR221 IMS04-B10 BC063489 ENST00000319511  
HGE112468 M01C081C20 pDONR221 IMS04-B10 BC063489 ENST00000319511  
HGE112516 M01C081E20 pDONR221 IMS04-B10 BC063489 ENST00000319511  
HGE112564 M01C081G20 pDONR221 IMS04-B10 BC063489 ENST00000319511  
HGE112612 M01C081I20 pDONR221 IMS04-B10 BC063489 ENST00000319511  
HGE112660 M01C081K20 pDONR221 IMS04-B10 BC063489 ENST00000319511  
HGE112708 M01C081M20 pDONR221 IMS04-B10 BC063489 ENST00000319511  
HGE112756 M01C081O20 pDONR221 IMS04-B10 BC063489 ENST00000319511  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050972 ARe27H04 pKA1U5 NM_024107.2  
GGGAGGCTGGGGCCAGGCAGCCCTTCGGTTCGGGTGGGCCCATGGACCCCAGTCCAACGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl